Home / Products /Genome Editing /gRNA plasmids /hCERS6 gRNA1 KO plasmidhCERS6 gRNA2 KO plasmidhCERS6 gRNA3 KO plasmid

hCERS6 gRNA1 KO plasmidhCERS6 gRNA2 KO plasmidhCERS6 gRNA3 KO plasmid

Catalog Number: GP05546

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCERS6 gRNA1 KO plasmidhCERS6 gRNA2 KO plasmidhCERS6 gRNA3 KO plasmid
gRNA sequence CGTGTTCTTCAGGTCCGCCCAGG(93,0.8),CCAGGGGAAAAGCGAGATAGAGG(76,0.75),GGCTCCCGCACAATGTCACCTGG(85,0.6)
Gene hCERS6
Gene ID 253782
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.