Home / Products /Genome Editing /gRNA plasmids /hCDKN2C gRNA1 KO plasmidhCDKN2C gRNA2 KO plasmid

hCDKN2C gRNA1 KO plasmidhCDKN2C gRNA2 KO plasmid

Catalog Number: GP05556

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCDKN2C gRNA1 KO plasmidhCDKN2C gRNA2 KO plasmid
gRNA sequence AAGTTGCTCTAGGTCCCCCCTGG(83,0.73),GACGCCAACTCGTTCCCCCAAGG(82,0.7)
Gene hCDKN2C
Gene ID 1031
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.