Home / Products /Genome Editing /gRNA plasmids /hCDKN2A gRNA1 KO plasmidhCDKN2A gRNA2 KO plasmid

hCDKN2A gRNA1 KO plasmidhCDKN2A gRNA2 KO plasmid

Catalog Number: GP08291

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCDKN2A gRNA1 KO plasmidhCDKN2A gRNA2 KO plasmid
gRNA sequence GCACGCGCGCCGAATCCGGAGGG(99,0.8),ACGAAAACCCTCACTCGCGGCGG(99,0.66)
Gene hCDKN2A
Gene ID 1029
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.