Home / Products /Genome Editing /gRNA plasmids /hCALD1 gRNA1 KO plasmidhCALD1 gRNA2 KO plasmidhCALD1 gRNA3 KO plasmid

hCALD1 gRNA1 KO plasmidhCALD1 gRNA2 KO plasmidhCALD1 gRNA3 KO plasmid

Catalog Number: GP05648

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCALD1 gRNA1 KO plasmidhCALD1 gRNA2 KO plasmidhCALD1 gRNA3 KO plasmid
gRNA sequence CTTGGGACAGGTGACCGACCAGG(89,0.77),ACGGCGCCGCCGAGCCCGACAGG(87,0.65),ATCATCGTCATTCCTCTGGTAGG(82,0.61)
Gene hCALD1
Gene ID 800
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.