Home / Products /Genome Editing /gRNA plasmids /hC9orf69 gRNA1 KO plasmidhC9orf69 gRNA2 KO plasmidhC9orf69 gRNA3 KO plasmid

hC9orf69 gRNA1 KO plasmidhC9orf69 gRNA2 KO plasmidhC9orf69 gRNA3 KO plasmid

Catalog Number: GP06134

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hC9orf69 gRNA1 KO plasmidhC9orf69 gRNA2 KO plasmidhC9orf69 gRNA3 KO plasmid
gRNA sequence GAGCGCACCCGCCGCGGAATGGG(98,0.66),CGGGCCCGCAGGCCGCATGCAGG(75,0.74),GGCAGGTGGTGTGCGGGCCGTGG(66,0.78)
Gene hC9orf69
Gene ID 90120
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.