Home / Products /Genome Editing /gRNA plasmids /hBRAP gRNA1 KO plasmidhBRAP gRNA2 KO plasmidhBRAP gRNA3 KO plasmid

hBRAP gRNA1 KO plasmidhBRAP gRNA2 KO plasmidhBRAP gRNA3 KO plasmid

Catalog Number: GP06466

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hBRAP gRNA1 KO plasmidhBRAP gRNA2 KO plasmidhBRAP gRNA3 KO plasmid
gRNA sequence CTCGACGGCCGAGATGCTGATGG(89,0.73),TGTTTAGAAGGCAAGTCACCAGG(78,0.65),ATAATCGCTACTTTCTCTCCTGG(75,0.7)
Gene hBRAP
Gene ID 8315
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.