Home / Products /Genome Editing /gRNA plasmids /hATG2A gRNA1 KO plasmidhATG2A gRNA2 KO plasmidhATG2A gRNA3 KO plasmid

hATG2A gRNA1 KO plasmidhATG2A gRNA2 KO plasmidhATG2A gRNA3 KO plasmid

Catalog Number: GP05750

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hATG2A gRNA1 KO plasmidhATG2A gRNA2 KO plasmidhATG2A gRNA3 KO plasmid
gRNA sequence TGCCCTGCGAGACATCCACCTGG(87,0.66),GCTCAGCCTCGATCTGTACAAGG(85,0.72),AGTAGTGGTGCAGCAAGTAGCGG(81,0.75)
Gene hATG2A
Gene ID 23130
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.