Home / Products /Genome Editing /gRNA plasmids /hATG101 gRNA1 KO plasmidhATG101 gRNA2 KO plasmidhATG101 gRNA3 KO plasmid

hATG101 gRNA1 KO plasmidhATG101 gRNA2 KO plasmidhATG101 gRNA3 KO plasmid

Catalog Number: GP05755

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hATG101 gRNA1 KO plasmidhATG101 gRNA2 KO plasmidhATG101 gRNA3 KO plasmid
gRNA sequence GAACTGTCGCTCGGAGGTGCTGG(82,0.66),CAAGTTCCACTACAAGAAGGAGG(76,0.74),GTGCTTCTGCACCGCAGCACAGG(67,0.66)
Gene hATG101
Gene ID 60673
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.