Home / Products /Genome Editing /gRNA plasmids /hASCC2 gRNA1 KO plasmidhASCC2 gRNA2 KO plasmidhASCC2 gRNA3 KO plasmid

hASCC2 gRNA1 KO plasmidhASCC2 gRNA2 KO plasmidhASCC2 gRNA3 KO plasmid

Catalog Number: GP06434

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hASCC2 gRNA1 KO plasmidhASCC2 gRNA2 KO plasmidhASCC2 gRNA3 KO plasmid
gRNA sequence TGTCCCCCGCAAATTCGACGAGG(100,0.78),TGAGAAAAACACTTCGATGGAGG(85,0.74),CCTTGTGAGTGGACATGCGGAGG(79,0.74)
Gene hASCC2
Gene ID 84164
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.