Home / Products /Genome Editing /gRNA plasmids /hANKRD52 gRNA1 KO plasmidhANKRD52 gRNA2 KO plasmidhANKRD52 gRNA3 KO plasmid

hANKRD52 gRNA1 KO plasmidhANKRD52 gRNA2 KO plasmidhANKRD52 gRNA3 KO plasmid

Catalog Number: GP07649

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hANKRD52 gRNA1 KO plasmidhANKRD52 gRNA2 KO plasmidhANKRD52 gRNA3 KO plasmid
gRNA sequence CCTGTTGAGCAGCCTCAACGTGG(91,0.83),CTGCACCATGCAGTGCATAGTGG(78,0.77),CAGAGCCTCAGCACACTTGGTGG(73,0.68)
Gene hANKRD52
Gene ID 283373
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.