Home / Products /Genome Editing /gRNA plasmids /hALDH3A2 gRNA1 KO plasmidhALDH3A2 gRNA2 KO plasmidhALDH3A2 gRNA3 KO plasmid

hALDH3A2 gRNA1 KO plasmidhALDH3A2 gRNA2 KO plasmidhALDH3A2 gRNA3 KO plasmid

Catalog Number: GP05833

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hALDH3A2 gRNA1 KO plasmidhALDH3A2 gRNA2 KO plasmidhALDH3A2 gRNA3 KO plasmid
gRNA sequence CGAAGTCCGGCGGGTCCGACAGG(99,0.67),GAAACCGCAGAGGTCGCGACCGG(96,0.66),CTTGCACAGGTCGGCGGCGATGG(93,0.65)
Gene hALDH3A2
Gene ID 224
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.