Home / Products /Genome Editing /gRNA plasmids /hABHD6 gRNA1 KO plasmidhABHD6 gRNA2 KO plasmidhABHD6 gRNA3 KO plasmid

hABHD6 gRNA1 KO plasmidhABHD6 gRNA2 KO plasmidhABHD6 gRNA3 KO plasmid

Catalog Number: GP06935

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hABHD6 gRNA1 KO plasmidhABHD6 gRNA2 KO plasmidhABHD6 gRNA3 KO plasmid
gRNA sequence TGTGATTGCGGGCGGCACGCTGG(95,0.68),GAAGCCACAAATGCCAGGATTGG(66,0.64),TCTGTTATTCCTTCCGGGGCAGG(85,0.69)
Gene hABHD6
Gene ID 57406
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.