Home / Products /Genome Editing /gRNA plasmids /mSlc7a11 gRNA1 KO plasmidmSlc7a11 gRNA2 KO plasmidmSlc7a11 gRNA3 KO plasmid

mSlc7a11 gRNA1 KO plasmidmSlc7a11 gRNA2 KO plasmidmSlc7a11 gRNA3 KO plasmid

Catalog Number: GP02816

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name mSlc7a11 gRNA1 KO plasmidmSlc7a11 gRNA2 KO plasmidmSlc7a11 gRNA3 KO plasmid
gRNA sequence GCTTGTACCTAATTCTGCAT
Gene mSlc7a11
Gene ID 26570
Fluorescence/resistance puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.