Home / Products /Genome Editing /gRNA plasmids /hWWC2 gRNA1 KO plasmidhWWC2 gRNA2 KO plasmid

hWWC2 gRNA1 KO plasmidhWWC2 gRNA2 KO plasmid

Catalog Number: GP06528

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hWWC2 gRNA1 KO plasmidhWWC2 gRNA2 KO plasmid
gRNA sequence GACCTTGCCGTCGTAGTCCCTGG(94,0.67),CAGCGGCAGCTGACCGCTCCCGG(86,0.81)
Gene hWWC2
Gene ID 80014
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.