Home / Products /Genome Editing /gRNA plasmids /hWNT5A gRNA1 KO plasmidhWNT5A gRNA2 KO plasmidhWNT5A gRNA3 KO plasmid

hWNT5A gRNA1 KO plasmidhWNT5A gRNA2 KO plasmidhWNT5A gRNA3 KO plasmid

Catalog Number: GP06596

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hWNT5A gRNA1 KO plasmidhWNT5A gRNA2 KO plasmidhWNT5A gRNA3 KO plasmid
gRNA sequence ATTGGCTTCAATTACAACCTGGG(83,0.75),TCCTGGGCTTAATATTCCAATGG(73,0.72),GTCTTCCAAGTTCTTCCTAGTGG(73,0.73)
Gene hWNT5A
Gene ID 7474
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.