Home / Products /Genome Editing /gRNA plasmids /hUSP13 gRNA1 KO plasmidhUSP13 gRNA2 KO plasmid

hUSP13 gRNA1 KO plasmidhUSP13 gRNA2 KO plasmid

Catalog Number: GP06304

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hUSP13 gRNA1 KO plasmidhUSP13 gRNA2 KO plasmid
gRNA sequence GCCGCCCGGCATGCCGAACAGGG(97,0.65),GACCTGGGCACGCGGATCGTGGG(97,0.75)
Gene hUSP13
Gene ID 8975
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.