Home / Products /Genome Editing /gRNA plasmids /hUBLCP1 gRNA1 KO plasmidhUBLCP1 gRNA2 KO plasmidhUBLCP1 gRNA3 KO plasmid

hUBLCP1 gRNA1 KO plasmidhUBLCP1 gRNA2 KO plasmidhUBLCP1 gRNA3 KO plasmid

Catalog Number: GP08075

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hUBLCP1 gRNA1 KO plasmidhUBLCP1 gRNA2 KO plasmidhUBLCP1 gRNA3 KO plasmid
gRNA sequence CCAGAACGCCAAAAGTTACTTGG(84,0.68),CCTATCATTGTAAAATGGGGTGG(69,0.65),AGCTTAACATCATTTTCTGCAGG(65,0.66)
Gene hUBLCP1
Gene ID 134510
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.