Home / Products /Genome Editing /gRNA plasmids /hTOR3A gRNA1 KO plasmidhTOR3A gRNA2 KO plasmidhTOR3A gRNA3 KO plasmid

hTOR3A gRNA1 KO plasmidhTOR3A gRNA2 KO plasmidhTOR3A gRNA3 KO plasmid

Catalog Number: GP06820

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hTOR3A gRNA1 KO plasmidhTOR3A gRNA2 KO plasmidhTOR3A gRNA3 KO plasmid
gRNA sequence GTGGCCCGACGACTGTGACGAGG(95,0.75),GAAGAGCGTCCAGTACCGCTTGG(94,0.65),CCAGGCCGAGCCCGGCTCGTCGG(82,0.75)
Gene hTOR3A
Gene ID 64222
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.