Home / Products /Genome Editing /gRNA plasmids /hTOMM34 gRNA1 KO plasmidhTOMM34 gRNA2 KO plasmidhTOMM34 gRNA3 KO plasmid

hTOMM34 gRNA1 KO plasmidhTOMM34 gRNA2 KO plasmidhTOMM34 gRNA3 KO plasmid

Catalog Number: GP03798

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hTOMM34 gRNA1 KO plasmidhTOMM34 gRNA2 KO plasmidhTOMM34 gRNA3 KO plasmid
gRNA sequence CCGCAACGGCCAGTACGCCGAGG(97,0.7),CAGCGCGCGGCCGTAGAGCGCGG(91,0.73),GGAGCTCCTCCACAGAGTCTGGG(69,0.76)
Gene hTOMM34
Gene ID 10953
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.