Home / Products /Genome Editing /gRNA plasmids /hTNFSF10 gRNA1 KO plasmidhTNFSF10 gRNA2 KO plasmid

hTNFSF10 gRNA1 KO plasmidhTNFSF10 gRNA2 KO plasmid

Catalog Number: GP03805

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hTNFSF10 gRNA1 KO plasmidhTNFSF10 gRNA2 KO plasmid
gRNA sequence GAAGATCACGATCAGCACGCAGG(92,0.69),ATGGCTATGATGGAGGTCCAGGG(80,0.68)
Gene hTNFSF10
Gene ID 8743
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.