Home / Products /Genome Editing /gRNA plasmids /hTFRC gRNA1 KO plasmidhTFRC gRNA2 KO plasmid

hTFRC gRNA1 KO plasmidhTFRC gRNA2 KO plasmid

Catalog Number: GP06668

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hTFRC gRNA1 KO plasmidhTFRC gRNA2 KO plasmid
gRNA sequence CTGCAGCACGTCGCTTATATTGG(97,0.7),CTACTTGGGCTATTGTAAAGGGG(75,0.82)
Gene hTFRC
Gene ID 7037
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.