Home / Products /Genome Editing /gRNA plasmids /hSUCLG1 gRNA1 KO plasmidhSUCLG1 gRNA2 KO plasmid

hSUCLG1 gRNA1 KO plasmidhSUCLG1 gRNA2 KO plasmid

Catalog Number: GP06334

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSUCLG1 gRNA1 KO plasmidhSUCLG1 gRNA2 KO plasmid
gRNA sequence TGCCGCTGACATCGCTACCATGG(96,0.66),GCGCGACAGGAGACGGGCGGCGG(82,0.84)
Gene hSUCLG1
Gene ID 8802
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.