Home / Products /Genome Editing /gRNA plasmids /hSRC gRNA1 KO plasmidhSRC gRNA2 KO plasmid

hSRC gRNA1 KO plasmidhSRC gRNA2 KO plasmid

Catalog Number: GP06733

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSRC gRNA1 KO plasmidhSRC gRNA2 KO plasmid
gRNA sequence CTATGACTATGAGTCTAGGACGG(86,0.69),ACAGACCTGTCCTTCAAGAAAGG(63,0.66)
Gene hSRC
Gene ID 6714
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.