Home / Products /Genome Editing /gRNA plasmids /hSPG11 gRNA1 KO plasmidhSPG11 gRNA2 KO plasmidhSPG11 gRNA3 KO plasmid

hSPG11 gRNA1 KO plasmidhSPG11 gRNA2 KO plasmidhSPG11 gRNA3 KO plasmid

Catalog Number: GP03987

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSPG11 gRNA1 KO plasmidhSPG11 gRNA2 KO plasmidhSPG11 gRNA3 KO plasmid
gRNA sequence CATCGGTAGAACCCGCCCCATGG(95,0.8),CCAGTCCCCGCCGAGGCGATGGG(94,0.77),GTCGCGAGTGCTGCTTCCGCCGG(92,0.7)
Gene hSPG11
Gene ID 80208
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.