Home / Products /Genome Editing /gRNA plasmids /hSMURF1 gRNA1 KO plasmidhSMURF1 gRNA2 KO plasmidhSMURF1 gRNA3 KO plasmid

hSMURF1 gRNA1 KO plasmidhSMURF1 gRNA2 KO plasmidhSMURF1 gRNA3 KO plasmid

Catalog Number: GP06946

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSMURF1 gRNA1 KO plasmidhSMURF1 gRNA2 KO plasmidhSMURF1 gRNA3 KO plasmid
gRNA sequence ATTCGATAACCATTAGCGTGTGG(96,0.72),TTTTAATCTGCTGATGGCATTGG(62,0.63),TGCAGTTCGTGGCCAGATAGTGG(87,0.71)
Gene hSMURF1
Gene ID 57154
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.