Home / Products /Genome Editing /gRNA plasmids /hSMAD4 gRNA1 KO plasmidhSMAD4 gRNA2 KO plasmidhSMAD4 gRNA3 KO plasmid

hSMAD4 gRNA1 KO plasmidhSMAD4 gRNA2 KO plasmidhSMAD4 gRNA3 KO plasmid

Catalog Number: GP04023

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSMAD4 gRNA1 KO plasmidhSMAD4 gRNA2 KO plasmidhSMAD4 gRNA3 KO plasmid
gRNA sequence TGTATGGTAACACATTTACTAGG(74,0.71),ACTATGCACAATGCTCAGACAGG(81,0.68),CACTCTCTCCACCTTGTCTATGG(72,0.62)
Gene hSMAD4
Gene ID 4089
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.