Home / Products /Genome Editing /gRNA plasmids /hSHPK gRNA1 KO plasmidhSHPK gRNA2 KO plasmidhSHPK gRNA3 KO plasmid

hSHPK gRNA1 KO plasmidhSHPK gRNA2 KO plasmidhSHPK gRNA3 KO plasmid

Catalog Number: GP04116

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSHPK gRNA1 KO plasmidhSHPK gRNA2 KO plasmidhSHPK gRNA3 KO plasmid
gRNA sequence GCTGCGCGGCCGATCACCCTCGG(96,0.81),CCAGCACTGCGAACCCGGATGGG(94,0.69),CGCCTCTGCCCGCGCAGCACGGG(82,0.73)
Gene hSHPK
Gene ID 23729
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.