Home / Products /Genome Editing /gRNA plasmids /hSDF4 gRNA1 KO plasmidhSDF4 gRNA2 KO plasmidhSDF4 gRNA3 KO plasmid

hSDF4 gRNA1 KO plasmidhSDF4 gRNA2 KO plasmidhSDF4 gRNA3 KO plasmid

Catalog Number: GP07251

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSDF4 gRNA1 KO plasmidhSDF4 gRNA2 KO plasmidhSDF4 gRNA3 KO plasmid
gRNA sequence GTTGGCTACTCTCTCTCGAGTGG(89,0.8),CCAGCTTCACCCCGTTCAGGTGG(89,0.67),CTGGACGCCATCGCCACCCAGGG(84,0.68)
Gene hSDF4
Gene ID 51150
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.