Home / Products /Genome Editing /gRNA plasmids /hPXK gRNA1 KO plasmidhPXK gRNA2 KO plasmid

hPXK gRNA1 KO plasmidhPXK gRNA2 KO plasmid

Catalog Number: GP04290

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPXK gRNA1 KO plasmidhPXK gRNA2 KO plasmid
gRNA sequence AGCAGCACCTTGCCGGCTGGCGG(84,0.79),CAGGCTCTGGCTCGCCTCGATGG(89,0.61)
Gene hPXK
Gene ID 54899
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.