Home / Products /Genome Editing /gRNA plasmids /hPUM3 gRNA1 KO plasmidhPUM3 gRNA2 KO plasmidhPUM3 gRNA3 KO plasmid

hPUM3 gRNA1 KO plasmidhPUM3 gRNA2 KO plasmidhPUM3 gRNA3 KO plasmid

Catalog Number: GP04294

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPUM3 gRNA1 KO plasmidhPUM3 gRNA2 KO plasmidhPUM3 gRNA3 KO plasmid
gRNA sequence CATCGCTTCTACCATCTGGCTGG(73,0.73),ACAAGGAAAGTTGCTAAAGAAGG(64,0.68),GTTCAAGAATAAGCAGCAAGGGG(64,0.64)
Gene hPUM3
Gene ID 9933
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.