Home / Products /Genome Editing /gRNA plasmids /hPPP2R5E gRNA1 KO plasmidhPPP2R5E gRNA2 KO plasmidhPPP2R5E gRNA3 KO plasmid

hPPP2R5E gRNA1 KO plasmidhPPP2R5E gRNA2 KO plasmidhPPP2R5E gRNA3 KO plasmid

Catalog Number: GP07052

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPPP2R5E gRNA1 KO plasmidhPPP2R5E gRNA2 KO plasmidhPPP2R5E gRNA3 KO plasmid
gRNA sequence GGCAGAGGTGTTAACTCAATAGG(84,0.61),GCCTTGAGACCTAAACTGTGAGG(85,0.62),ACCAACTACTCCTCCATCAGTGG(68,0.66)
Gene hPPP2R5E
Gene ID 5529
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.