Home / Products /Genome Editing /gRNA plasmids /hPPP2R5C gRNA1 KO plasmidhPPP2R5C gRNA2 KO plasmidhPPP2R5C gRNA3 KO plasmid

hPPP2R5C gRNA1 KO plasmidhPPP2R5C gRNA2 KO plasmidhPPP2R5C gRNA3 KO plasmid

Catalog Number: GP04380

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPPP2R5C gRNA1 KO plasmidhPPP2R5C gRNA2 KO plasmidhPPP2R5C gRNA3 KO plasmid
gRNA sequence TTCCACTTTAGGTCACTTAGTGG(82,0.66),AGCTTCTCTTGATCAGCAGGAGG(68,0.62),GGTGGTACTTTAGGGCTTGAGGG(81,0.71)
Gene hPPP2R5C
Gene ID 5527
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.