Home / Products /Genome Editing /gRNA plasmids /hPPP1R16A gRNA1 KO plasmidhPPP1R16A gRNA2 KO plasmidhPPP1R16A gRNA3 KO plasmid

hPPP1R16A gRNA1 KO plasmidhPPP1R16A gRNA2 KO plasmidhPPP1R16A gRNA3 KO plasmid

Catalog Number: GP06384

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPPP1R16A gRNA1 KO plasmidhPPP1R16A gRNA2 KO plasmidhPPP1R16A gRNA3 KO plasmid
gRNA sequence GGCCGCTGCCCGAAATGACCTGG(90,0.67),CCAGAAGCGGCGCGCCCAGCAGG(74,0.65),TGGCTGGCTGCCTCCTTCCGGGG(65,0.84)
Gene hPPP1R16A
Gene ID 84988
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.