Home / Products /Genome Editing /gRNA plasmids /hPLTP gRNA1 KO plasmidhPLTP gRNA2 KO plasmidhPLTP gRNA3 KO plasmid

hPLTP gRNA1 KO plasmidhPLTP gRNA2 KO plasmidhPLTP gRNA3 KO plasmid

Catalog Number: GP07152

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPLTP gRNA1 KO plasmidhPLTP gRNA2 KO plasmidhPLTP gRNA3 KO plasmid
gRNA sequence CCGCGTCACCTCCAAGGCGCTGG(88,0.67),CTAGGAAGAGGGCCCCGAAGAGG(83,0.85),GGCGCACATGCAGAGTTCCCAGG(76,0.7)
Gene hPLTP
Gene ID 5360
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.