Home / Products /Genome Editing /gRNA plasmids /hPIGR gRNA1 KO plasmidhPIGR gRNA2 KO plasmidhPIGR gRNA3 KO plasmid

hPIGR gRNA1 KO plasmidhPIGR gRNA2 KO plasmidhPIGR gRNA3 KO plasmid

Catalog Number: GP04467

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPIGR gRNA1 KO plasmidhPIGR gRNA2 KO plasmidhPIGR gRNA3 KO plasmid
gRNA sequence TCCCATATTTGGTCCCGAGGAGG(93,0.68),GGGTGGGTAGTAGCACGTGATGG(91,0.65),CCGGGTGTGCCGGTTGACAGAGG(91,0.87)
Gene hPIGR
Gene ID 5284
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.