Home / Products /Genome Editing /gRNA plasmids /hPI4K2B gRNA1 KO plasmidhPI4K2B gRNA2 KO plasmid

hPI4K2B gRNA1 KO plasmidhPI4K2B gRNA2 KO plasmid

Catalog Number: GP04475

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPI4K2B gRNA1 KO plasmidhPI4K2B gRNA2 KO plasmid
gRNA sequence GTCCGCGGACGCCAACCGGTCGG(98,0.65),CCAGCTCGGCGGACGAACTCCGG(97,0.77)
Gene hPI4K2B
Gene ID 55300
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.