Home / Products /Genome Editing /gRNA plasmids /hPARP10 gRNA1 KO plasmidhPARP10 gRNA2 KO plasmidhPARP10 gRNA3 KO plasmid

hPARP10 gRNA1 KO plasmidhPARP10 gRNA2 KO plasmidhPARP10 gRNA3 KO plasmid

Catalog Number: GP04538

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPARP10 gRNA1 KO plasmidhPARP10 gRNA2 KO plasmidhPARP10 gRNA3 KO plasmid
gRNA sequence GAAAACCGCCGACGCTCTGGAGG(94,0.71),AGTGAGCAGCTCGTCGGGCACGG(92,0.7),AGTCTCTGCCAGCTCAACACAGG(79,0.82)
Gene hPARP10
Gene ID 84875
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.