Home / Products /Genome Editing /gRNA plasmids /hNR4A1 gRNA1 KO plasmidhNR4A1 gRNA2 KO plasmidhNR4A1 gRNA3 KO plasmid

hNR4A1 gRNA1 KO plasmidhNR4A1 gRNA2 KO plasmidhNR4A1 gRNA3 KO plasmid

Catalog Number: GP04605

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hNR4A1 gRNA1 KO plasmidhNR4A1 gRNA2 KO plasmidhNR4A1 gRNA3 KO plasmid
gRNA sequence CCCATATTGGGCTTGGATACAGG(93,0.66),TCCTGTGTAGCCGTCCATGAAGG(89,0.69),CGGGGTCCCGGACTCGGTGCTGG(87,0.8)
Gene hNR4A1
Gene ID 3164
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.