Home / Products /Genome Editing /gRNA plasmids /hNONO gRNA1 KO plasmidhNONO gRNA2 KO plasmid

hNONO gRNA1 KO plasmidhNONO gRNA2 KO plasmid

Catalog Number: GP04633

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hNONO gRNA1 KO plasmidhNONO gRNA2 KO plasmid
gRNA sequence CTGGACAATATGCCACTCCGTGG(72,0.66),GTATGTGTCCAACGAACTGCTGG(66,0.6)
Gene hNONO
Gene ID 4841
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.