Home / Products /Genome Editing /gRNA plasmids /hNDUFB5 gRNA1 KO plasmidhNDUFB5 gRNA2 KO plasmidhNDUFB5 gRNA3 KO plasmid

hNDUFB5 gRNA1 KO plasmidhNDUFB5 gRNA2 KO plasmidhNDUFB5 gRNA3 KO plasmid

Catalog Number: GP04667

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hNDUFB5 gRNA1 KO plasmidhNDUFB5 gRNA2 KO plasmidhNDUFB5 gRNA3 KO plasmid
gRNA sequence GCGGGTTTCGGTTACTGCGGTGG(98,0.79),CTTGGCACTCGCCTCGGATTTGG(97,0.76),TGGCGGCCATGAGTTTGTTGCGG(81,0.88)
Gene hNDUFB5
Gene ID 4711
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.