Home / Products /Genome Editing /gRNA plasmids /hNCOA3 gRNA1 KO plasmidhNCOA3 gRNA2 KO plasmidhNCOA3 gRNA3 KO plasmid

hNCOA3 gRNA1 KO plasmidhNCOA3 gRNA2 KO plasmidhNCOA3 gRNA3 KO plasmid

Catalog Number: GP06483

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hNCOA3 gRNA1 KO plasmidhNCOA3 gRNA2 KO plasmidhNCOA3 gRNA3 KO plasmid
gRNA sequence AAATTGCCATGTGATACTCCAGG(79,0.74),TTTCGTGAATCACTGGCCAGTGG(75,0.87),CAGTGGTGAAAAACGGAGACGGG(84,0.65),ATTGTCAATATCACTAAGATTGG(74,0.69),TTTAAAATCGCACATTTATCTGG(70,0.62)
Gene hNCOA3
Gene ID 8202
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.