Home / Products /Genome Editing /gRNA plasmids /hNCK2 gRNA1 KO plasmidhNCK2 gRNA2 KO plasmid

hNCK2 gRNA1 KO plasmidhNCK2 gRNA2 KO plasmid

Catalog Number: GP04681

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hNCK2 gRNA1 KO plasmidhNCK2 gRNA2 KO plasmid
gRNA sequence CTATGTACCGTCCAACTACGTGG(96,0.67),CTGGGCGGTGTAGTCCCACTTGG(89,0.73)
Gene hNCK2
Gene ID 8440
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.