Home / Products /Genome Editing /gRNA plasmids /hMTMR3 gRNA1 KO plasmidhMTMR3 gRNA2 KO plasmidhMTMR3 gRNA3 KO plasmid

hMTMR3 gRNA1 KO plasmidhMTMR3 gRNA2 KO plasmidhMTMR3 gRNA3 KO plasmid

Catalog Number: GP04723

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hMTMR3 gRNA1 KO plasmidhMTMR3 gRNA2 KO plasmidhMTMR3 gRNA3 KO plasmid
gRNA sequence CCTTTGAGCAGTGTCAAGAGTGG(77,0.76),AGACCTCCATGCACCAAGCATGG(77,0.66),CTTCTATTTTAGCAGGTGGTCGG(73,0.72)
Gene hMTMR3
Gene ID 8897
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.