Home / Products /Genome Editing /gRNA plasmids /hMC2R gRNA1 KO plasmidhMC2R gRNA2 KO plasmidhMC2R gRNA3 KO plasmid

hMC2R gRNA1 KO plasmidhMC2R gRNA2 KO plasmidhMC2R gRNA3 KO plasmid

Catalog Number: GP07399

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hMC2R gRNA1 KO plasmidhMC2R gRNA2 KO plasmidhMC2R gRNA3 KO plasmid
gRNA sequence TAATTCCGACTGTCCTCGTGTGG(95,0.77),TATTCTTGAACACAGCCAGCAGG(74,0.62),ATTCTCCAAAACTCCAACAATGG(64,0.75)
Gene hMC2R
Gene ID 4158
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.