Home / Products /Genome Editing /gRNA plasmids /hMAP4K4 gRNA1 KO plasmidhMAP4K4 gRNA2 KO plasmidhMAP4K4 gRNA3 KO plasmid

hMAP4K4 gRNA1 KO plasmidhMAP4K4 gRNA2 KO plasmidhMAP4K4 gRNA3 KO plasmid

Catalog Number: GP04822

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hMAP4K4 gRNA1 KO plasmidhMAP4K4 gRNA2 KO plasmidhMAP4K4 gRNA3 KO plasmid
gRNA sequence GTTCTTCACAAGGTCTGTAATGG(81,0.8),TTATGGAGTTCTGTGGGGCTGGG(61,0.69),ACATCTCCAGAGAAATCCTGAGG(60,0.67)
Gene hMAP4K4
Gene ID 9448
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.