Home / Products /Genome Editing /gRNA plasmids /hMAP3K11 gRNA1 KO plasmidhMAP3K11 gRNA2 KO plasmidhMAP3K11 gRNA3 KO plasmid

hMAP3K11 gRNA1 KO plasmidhMAP3K11 gRNA2 KO plasmidhMAP3K11 gRNA3 KO plasmid

Catalog Number: GP04833

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hMAP3K11 gRNA1 KO plasmidhMAP3K11 gRNA2 KO plasmidhMAP3K11 gRNA3 KO plasmid
gRNA sequence CGGGTTATGCCAACCCGGTGTGG(98,0.76),ACTGGGCTCGTAGTCGAACAGGG(98,0.8),AGCCGAGAGCGTTCGCCAGGAGG(95,0.76)
Gene hMAP3K11
Gene ID 4296
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.