Home / Products /Genome Editing /gRNA plasmids /hMAN1A1 gRNA1 KO plasmidhMAN1A1 gRNA2 KO plasmidhMAN1A1 gRNA3 KO plasmid

hMAN1A1 gRNA1 KO plasmidhMAN1A1 gRNA2 KO plasmidhMAN1A1 gRNA3 KO plasmid

Catalog Number: GP04843

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hMAN1A1 gRNA1 KO plasmidhMAN1A1 gRNA2 KO plasmidhMAN1A1 gRNA3 KO plasmid
gRNA sequence CTCGTGGTTTTCGCGGATCCTGG(98,0.74),GGCTGCTGAAGAGCGGCAACAGG(89,0.66),CCGGGCTTGTGGTCGGCGGCCGG(80,0.72)
Gene hMAN1A1
Gene ID 4121
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.