Home / Products /Genome Editing /gRNA plasmids /hLGALS3 gRNA1 KO plasmidhLGALS3 gRNA2 KO plasmidhLGALS3 gRNA3 KO plasmid

hLGALS3 gRNA1 KO plasmidhLGALS3 gRNA2 KO plasmidhLGALS3 gRNA3 KO plasmid

Catalog Number: GP04891

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hLGALS3 gRNA1 KO plasmidhLGALS3 gRNA2 KO plasmidhLGALS3 gRNA3 KO plasmid
gRNA sequence CATGATGCGTTATCTGGGTCTGG(85,0.66),GGCTGGTTCCCCCATGCGCCAGG(85,0.68),TCCTATCCTGGGGCCTACCCCGG(74,0.65)
Gene hLGALS3
Gene ID 3958
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.