Home / Products /Genome Editing /gRNA plasmids /hLAMA3 gRNA1 KO plasmidhLAMA3 gRNA2 KO plasmidhLAMA3 gRNA3 KO plasmid

hLAMA3 gRNA1 KO plasmidhLAMA3 gRNA2 KO plasmidhLAMA3 gRNA3 KO plasmid

Catalog Number: GP04912

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hLAMA3 gRNA1 KO plasmidhLAMA3 gRNA2 KO plasmidhLAMA3 gRNA3 KO plasmid
gRNA sequence ATCCCGAGCGGTCGCCCCGCAGG(96,0.65),CTCTACTGCAAGTTGGTCGGGGG(95,0.69),GGTTGAAGTAAGTCGGGTGAAGG(94,0.72)
Gene hLAMA3
Gene ID 3909
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.