Home / Products /Genome Editing /gRNA plasmids /hKIF7 gRNA1 KO plasmidhKIF7 gRNA2 KO plasmid

hKIF7 gRNA1 KO plasmidhKIF7 gRNA2 KO plasmid

Catalog Number: GP07474

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hKIF7 gRNA1 KO plasmidhKIF7 gRNA2 KO plasmid
gRNA sequence CAGCAGTGGTCGAACTCGCAGGG(96,0.67),GGAAGCCAAAGTGTCGGTCACGG(93,0.72)
Gene hKIF7
Gene ID 374654
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.